A method of detecting a neurodegenerative disease in a mammal, which method comprises assaying the copy number of a Cripto-1 gene or the expression level of a Cripto-1 gene product in the central nervous system of the mammal, wherein an amplification of the Cripto-1 gene or an overexpression of the Cripto-1 gene product is indicative of a neurodegenerative disease in the mammal; a method of inhibiting progression of a neurodegenerative disease in a mammal, which method comprises administering to the mammal an agent that inhibits Cripto-1 in an amount effective to inhibit Cripto-1 in the central nervous system of the mammal, whereupon the progression of the neurodegenerative disease is inhibited; and an isolated or purified oligonucleotide consisting essentially of the sequence of AAGCTATGGACTGCAGGAAGATGG (SEQ ID NO: 3) or AGAAGGCAGATGCCACTAGC (SEQ ID NO: 4).