An immunostimulatory oligonucleotide that is represented by the general formula 5'-Gm-GACGATCGTC-Gn-3' or 5'-Gm-CACGATCGTG-Gn-3' (in the formula, m and n are each independently an integer from 1 to 9 and m+n=10) and that comprises any of the following base sequences: TABLE-US-00001 GGACGATCGTCGGGGGGGGG, (SEQ ID NO: 1) GGGACGATCGTCGGGGGGGG, (SEQ ID NO: 2) GGGGACGATCGTCGGGGGGG, (SEQ ID NO: 3) GGGGGGGACGATCGTCGGGG, (SEQ ID NO: 4) GGGGGGGGACGATCGTCGGG, (SEQ ID NO: 5) GGGGGGGGGACGATCGTCGG, (SEQ ID NO: 6) GGGGGGGGGGACGATCGTCG, (SEQ ID NO: 7) and GGGGGGGGGCACGATCGTGG. (SEQ ID NO: 8)

 
Web www.patentalert.com

> RNA interference mediated inhibition of winged helix nude (WHN) gene expression using short interfering nucleic acid (siNA)

~ 00366